generic e Search Results


95
Agilent technologies 1260 infinity chromatograph
1260 Infinity Chromatograph, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1260 infinity chromatograph/product/Agilent technologies
Average 95 stars, based on 1 article reviews
1260 infinity chromatograph - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

90
Generi Biotech gene-specific primers (supplementary table s5)
Gene Specific Primers (Supplementary Table S5), supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene-specific primers (supplementary table s5)/product/Generi Biotech
Average 90 stars, based on 1 article reviews
gene-specific primers (supplementary table s5) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biotechnology Information generif
Generif, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/generif/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
generif - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Merck KGaA dntps
Dntps, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntps/product/Merck KGaA
Average 90 stars, based on 1 article reviews
dntps - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech oligonucleotide primers
Oligonucleotide Primers, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotide primers/product/Generi Biotech
Average 90 stars, based on 1 article reviews
oligonucleotide primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech control odn 1982
Control Odn 1982, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control odn 1982/product/Generi Biotech
Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech synthetic oligonucleotides temp fvl-a
Synthetic Oligonucleotides Temp Fvl A, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic oligonucleotides temp fvl-a/product/Generi Biotech
Average 90 stars, based on 1 article reviews
synthetic oligonucleotides temp fvl-a - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech oligonucleotide 5′-tatttctgatgtccaccccc-3′
Oligonucleotide 5′ Tatttctgatgtccaccccc 3′, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotide 5′-tatttctgatgtccaccccc-3′/product/Generi Biotech
Average 90 stars, based on 1 article reviews
oligonucleotide 5′-tatttctgatgtccaccccc-3′ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech epsilon_fw_ndei epsilon_rev_xhoi
Bacterial strains, plasmids, and primers used in this study.
Epsilon Fw Ndei Epsilon Rev Xhoi, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/epsilon_fw_ndei epsilon_rev_xhoi/product/Generi Biotech
Average 90 stars, based on 1 article reviews
epsilon_fw_ndei epsilon_rev_xhoi - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech oligonucleotides complementary individual h. pylori genomic dna fragments
Bacterial strains, plasmids, and primers used in this study.
Oligonucleotides Complementary Individual H. Pylori Genomic Dna Fragments, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotides complementary individual h. pylori genomic dna fragments/product/Generi Biotech
Average 90 stars, based on 1 article reviews
oligonucleotides complementary individual h. pylori genomic dna fragments - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech gbsg pcr master mix
Bacterial strains, plasmids, and primers used in this study.
Gbsg Pcr Master Mix, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gbsg pcr master mix/product/Generi Biotech
Average 90 stars, based on 1 article reviews
gbsg pcr master mix - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Generi Biotech primers for sequencing and mutagenesis
Bacterial strains, plasmids, and primers used in this study.
Primers For Sequencing And Mutagenesis, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers for sequencing and mutagenesis/product/Generi Biotech
Average 90 stars, based on 1 article reviews
primers for sequencing and mutagenesis - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Bacterial strains, plasmids, and primers used in this study.

Journal: Toxins

Article Title: Targeted Mass Spectrometry Analysis of Clostridium perfringens Toxins

doi: 10.3390/toxins11030177

Figure Lengend Snippet: Bacterial strains, plasmids, and primers used in this study.

Article Snippet: epsilon_FW_NdeI epsilon_REV_XhoI , CCACATATGAAAAAAAATCTTGTAAAAAGTTTAG TGGCTCGAGTTTTATTCCTGGTGCCTTAATATAAA , Generi Biotech.

Techniques: Isolation, Expressing, Plasmid Preparation, Planar Chromatography, Sequencing